Phosphohistidine phosphatase
WebPhosphohistidine phosphatase 1 (PHPT1), also named protein histidine phosphatase (PHP), is a eukaryotic enzyme dephosphorylating proteins and peptides that are phosphorylated on a histidine residue. WebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase: Lhpp: CCCTGGGAAAAGGACGCTATT AATCATGATGGCCTGGTGGG: Mechanistic target of rapamycin kinase: Mtor: CACCCATCCAACCTGATGCT ATCGAGACCGGTAACCTCCA: Regulatory associated protein of MTOR, complex 1: Rptor: TGGGTCTTCAACAAGGTAGC …
Phosphohistidine phosphatase
Did you know?
WebResearch in the field of protein-bound phosphohistidine phosphorylation has been hampered by the difficulties in analysis and detection of phosphohistidine. Therefore a … Although a clear consensus has not been reached, a large number of scientists adhere to a substrate-transport model to account for the catalytic properties of glucose 6-phosphatase. In this model, glucose 6-phosphatase has a low degree of selectivity. The transfer of the glucose 6-phosphate is carried out by a transporter protein (T1) and the endoplasmic reticulum (ER) contains structures allowing the exit of the phosphate group (T2) and glucose (T3).
WebNov 10, 2006 · Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. WebMar 1, 2002 · Such a phosphohistidine phosphatase, if present, should also serve as a modulator for the His-Asp phosphorelay. In this study, we intended to find such a hypothetical protein, and the E. coli SixA protein was identified as a candidate that interacts with the HPt domain of the ArcB anaerobic sensory kinase, through its dephosphorylation …
WebJul 24, 2024 · Yokoi et al. (2003) concluded that LHPP, like bovine Lhpp, may function as a protein phosphatase that hydrolyzes phospholysine and/or phosphohistidine. Hindupur et al. (2024) demonstrated that LHPP is indeed a protein histidine phosphatase. Consistent with these observations, global histidine phosphorylation was significantly upregulated in ... WebNov 28, 2024 · Phosphohistidine phosphatase 1 (PHPT1), one of the few known protein pHis phosphatases, regulates important cellular processes, and its genetic knockdown …
Web14 kDa phosphohistidine phosphatase is an enzyme that in humans is encoded by the PHPT1 gene. References Further reading. This page was last edited on 13 October 2024, at 19:25 (UTC). Text is available under the Creative Commons Attribution-ShareAlike License 3.0; additional terms ...
WebSep 27, 2024 · The K Ca 3.1 auxiliary subunits that positively or negatively control its activity as well as T-cell function have been identified: phosphoinositide-3-kinase, class 2, β polypeptide (PI3K-C2B), nucleoside diphosphate kinase-B (NDPK-B), phosphohistidine phosphatase 1 (PHPT1), myotubularin-related protein 6 (MTMR6), tripartite motif … small farming tractorsWebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including … small fry community playgroupsmall floral wallpaperWebAug 21, 2015 · Structures of the three forms of phosphohistidine: (A) 1-phosphohistidine; (B) 3-phosphohistidine; (C) 1,3-diphosphohistidine. In prokaryotes it is now recognized that that both serine/threonine and tyrosine kinases, as well as their cognate phosphatases also occur (for reviews, see Bakal and Davies, 2000; Pereira et al., 2011; Chao et al., 2014 ). small flower bed rakeWebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including those involved in signaling,... small fixing plateWebkaryotic and eukaryotic phosphohistidine phosphatases have been reported. Here we identify the mechanism by which a bacterial phosphohistidine phosphatase … small food business in londonWebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase - Wikipedia Phospholysine phosphohistidine inorganic pyrophosphate phosphatase Phospholysine … small folding backgammon board